| 產(chǎn)品名稱 | Candida albicans (Robin) Berkhout |
|---|---|
| 商品貨號 | B166016 |
| Strain Designations | 3147 [CBS 6431, CCY 29-3-106, CIP 48.72, DSM 1386, IFO 1594, NCPF 3179, NCYC 1363, NIH 3147, VTT C-85161] |
| Application | Assay of amphotericin B fungizone Assay of antimicrobial preservatives Assay of haloprogin Assay of nystatin fungicidin Media testing Membrane filter testing Preparatory test control Produces D-arabinolactone oxidase Produces DNA topoisomerase Food testing Pharmaceutical and Personal Care Produces aspartic proteinases aspartyl proteinases Produces estrogen-binding protein Produces lanosterol synthase 2,3-oxidosqualene lanosterol cyclase Produces phenethyl alcohol Produces polyamine oxidase Produces tryptophol Quality control strain Sterility testing Testing Testing fungicides Produces farnesoic acid, an autoregulatory substance capable of regulating morphological transition Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM) This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified. |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Antigenic Properties | Serotype A
Ref  Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Genome sequencing strain (Xiamen Medical College, China) This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979-91 where only the taxon is specified.
For sterility testing, not more than five passages from the ATCC culture should be used
Growth and invasiveness in mouse
Steroid interference with antifungal activity
Cell wall hydrophobicity enhances corticosterone incorporation
Ultraviolet microscopy
Calcification
Morphology and physiology of strain sectors
Use of impedance for preservative efficacy testing
Fungitoxicity of alcohols and fatty acids
Esterase activity
Lipid composition
Effect of antineoplastic drugs |
| Morphology | On YEPD agar after 2 days at 25°C, colonies are cream-colored, shiny, and smooth. Older colonies show filaments-like structure at the margin and may have ridges or folders. Cells are ovoid (3.0-6.0 x 4.0-8.0 μm), budding, mostly singly and rarely clustered in young culture. Cells will elongate and form chain-like branched pseudohyphae in older culture. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 1245: YEPD |
| Growth Conditions | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Viability | post-FreezeViability test |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAA |
| Name of Depositor | CW Emmons |
| Special Collection | ATCC |
| Chain of Custody | ATCC <-- CW Emmons <-- Wright |
| Isolation | Man with bronchomycosis |
| Cross References | Nucleotide (GenBank) : KU729138 D1/D2 region of 26S rRNA gene Nucleotide (GenBank) : D86430 Candida albicans gene for CaRho1, complete cds. Nucleotide (GenBank) : AX109674 Sequence 407 from Patent WO0123604. Nucleotide (GenBank) : X56867 C. albicans gene for secretory aspartate proteinase. Nucleotide (GenBank) : AF031229 Candida albicans alternative oxidase (AOX1) gene, complete cds. Nucleotide (GenBank) : U38534 Candida albicans alpha-tubulin (TUB1) gene, complete cds. Nucleotide (GenBank) : L22737 Candida albicans inositol-1-phosphate synthase (IN01) gene, complete cds. Nucleotide (GenBank) : AF031228 Candida albicans D-arabinono-1,4-lactone oxidase (ALO) gene, Nucleotide (GenBank) : U40454 Candida albicans topoisomerase type I (CATOP1) gene, complete cds. Nucleotide (GenBank) : EU266569 ITS including 5.8S rRNA gene |
| References | Lingappa BT, et al. Phenethyl alcohol and tryptophol: autoantibiotics produced by the fungus Candida albicans. Science 163: 192-194, 1969. PubMed: 5762768 Skowronski R, Feldman D. Characterization of an estrogen-binding protein in the yeast Candida albicans. Endocrinology 124: 1965-1972, 1989. PubMed: 2647470 Connolly P, et al. The use of impedance for preservative efficacy testing of pharmaceuticals and cosmetic products. J. Appl. Bacteriol. 76: 68-74, 1994. PubMed: 8144407 Klig LS, et al. Comparison of INO1 gene sequences and products in Candida albicans and Saccharomyces cerevisiae. Yeast 10: 789-800, 1994. PubMed: 7975896 ASTM International Standard Test Method for Preservatives in Water-Containing Cosmetics. West Conshohocken, PA British Pharmacopoeia Commission Test for sterility. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI A, 2003 British Pharmacopoeia Commission Tests for microbial contamination. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI B, 2003 British Pharmacopoeia Commission Efficacy of antimicrobial preservation. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XVI C, 2003 Gershon H, Shanks L. Antifungal properties of n-alkanols, alpha, omega-n-alkanediols, and omega-chloro-alpha-alkanols. J. Pharm. Sci. 69: 381-384, 1980. PubMed: 7373528 Shen LL, et al. DNA topoisomerases from pathogenic fungi: targets for the discovery of antifungal drugs. Antimicrob. Agents Chemother. 36: 2778-2784, 1992. PubMed: 1336349 Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150 Phillips AW, Balish E. Growth and invasiveness of Candida albicans in the germ-free and conventional mouse after oral challenge. Appl. Microbiol. 14: 737-741, 1966. PubMed: 5970461 Zygmunt WA, Tavormina PA. Steroid interference with antifungal activity of polyene antibiotics. Appl. Microbiol. 14: 865-869, 1966. Ghannoum MA, Al-Khars A. Effect of antineoplastic agents on the growth and ultrastructure of Candida albicans. Mykosen 27: 452-464, 1984. PubMed: 6438503 . . Dev. Ind. Microbiol. 21: 373-378, 1980. Saltarelli CG. Morphological and physiological variations between sectors isolated from giant colonies of Candida albicans and C. stellatoidea. Mycopathol Mycol Appl 34: 209-220, 1968. Braun PC. Surface hydrophobicity enhances corticosterone incorporation in Candida albicans. Infect. Immun. 62: 4087-4090, 1994. PubMed: 8063431 Balish E, Svihla G. Ultraviolet microscopy of Candida albicans. J. Bacteriol. 92: 1812-1820, 1966. PubMed: 5958110 Balliano G, et al. Inhibition of sterol biosynthesis in Saccharomyces cerevisiae and Candida albicans by 22,23-epoxy-2-aza-2,3-dihydrosqualene and the corresponding N-oxide. Antimicrob. Agents Chemother. 38: 1904-1908, 1994. PubMed: 7810997 Huh WK, et al. Characterisation of D-arabinono-1,4-lactone oxidase from Candida albicans ATCC 10231. Eur. J. Biochem. 225: 1073-1079, 1994. PubMed: 7957197 Ennever J, Summers FE. Calcification by Candida albicans. J. Bacteriol. 122: 1391-1393, 1975. PubMed: 238948 Lerner CG, Goldman RC. Stimuli that induce production of Candida albicans extracellular aspartyl proteinase. J. Gen. Microbiol. 139: 1643-1651, 1993. PubMed: 7690395 European Pharmacopoeia Commission Microbial contamination of products not required to comply with the test for sterility (total viable aerobic count). Strasbourg, France:European Pharmacopoeia Commission;European Pharmacopoeia EP 2.6.12, 1997 European Pharmacopoeia Commission Efficacy of antimicrobial preservation. Strasbourg, France:European Pharmacopoeia Commission;European Pharmacopoeia EP 5.1.3, 1997 Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3. US Food & Drug Administration. GENERAL BIOLOGICAL PRODUCTS STANDARDS; General Provisions; Sterility Code of Federal Regulations Title 21: 21CFR610.12, Subpart B, 2005 U.S. Pharmacopeia General Chapters:<51> ANTIMICROBIAL EFFECTIVENESS TESTING. Rockville, MD:U.S. Pharmacopeia;USP USP34-NF29, 2011 U.S. Pharmacopeia General Chapters: <71> STERILITY TESTS. Rockville, MD:U.S. Pharmacopeia;USP USP34-NF29, 2011 U.S. Pharmacopeia Dietary Supplement Chapters: <2021> Microbial Enumeration Tests-Nutritional and Dietary Supplements. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011 Kondoh O, et al. Cloning of the RHO1 gene from Candida albicans and its regulation of beta-1,3-glucan synthesis. J. Bacteriol. 179: 7734-7741, 1997. PubMed: 9401032 Huh WK, Kang SO. Molecular cloning and functional expression of alternative oxidase from Candida albicans. J. Bacteriol. 181: 4098-4102, 1999. PubMed: 10383980 Oh KB, et al. Purification and characterization of an autoregulatory substance capable of regulating the morphological transition in Candida albicans. Proc. Natl. Acad. Sci. USA 98: 4664-4668, 2001. PubMed: 11274356 Isobe K, et al. Differential determination procedure for putrescine, spermidine and spermine with polyamine oxidase from fungi and putrescine oxidase. Agric. Biol. Chem. 45: 727-733, 1981. Yamada H, et al. Oxidation of polyamines by fungal enzymes. Agric. Biol. Chem. 44: 2469-2476, 1980. Bowman FW, et al. Collaborative study of aerobic media for sterility testing by membrane filtration. J. Pharm. Sci. 60: 1087-1088, 1971. PubMed: 5000479 Harrison EF, Zygmunt WA. Haloprogin: Mode of action studies in Candida albicans. Can. J. Microbiol. 20: 1241-1245, 1974. PubMed: 4608935 Applied Biosystems, MicroSeq Pharmaceutical Validation Panel. YT MicroPlate QC Set. Biolog. Supplemental assay method for testing for preservative interference with sterility tests. :US Department of Agriculture;USDA, Center for Veterinary Biologics STSAM0903.01, 1999 Efficacy of Preservation on Non-Eye Area Water-Miscible Cosmetic and Toiletry Formaulations. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 998.10. Microbial limit test for crude drugs. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.36. Sterility test, Growth promotion test. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.54. Preservatives-effectiveness test. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part II.12. Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003. Ophthalmic optics--Contact lens care products--Microbiological requirements and test methods for products and regimens for hygienic management of contact lenses. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14729:2001. Ophthalmic optics--Contact lens care products--Antimicrobial preservative efficacy testing and guidance on determining discard date. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14730:2000. Applied Biosystems, MicroSeq PHL Panel. Medical microbiology -- Culture media -- Part 2: Ready-to-use blood culture systems. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58942-2: 2004, 2004 Chemical disinfectants and antiseptics -- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas -- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1650:1998. Standard Test Method for Confirming the Sterility of Membrane Filters. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4196-05. Standard Test Method for Efficacy of Fungal Control Agents as Preservatives for Aqueous-Based Products Used in the Paper Industry. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 0875-00 (Reapproved 2005). Chemical disinfectants and antiseptics - Preservation of test organisms used for the determination of bactericidal, sporicidal and fungicidal activity. London, UK:British Standards Institution;British Standard BS EN 12353:2006. Chemical disinfectants and antiseptics --- Quantitative non-porous surface test for the evaluation of bactericidal and/or fungicidal activity of chemical disinfectants used in food, industrial, domestic and institutional areas --- Test method and requirements without mechanical action (phase 2/step 2). London, UK:British Standards Institution;British Standard BS EN 13697:2001. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants for instruments used in the medical area --- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 13624:2003. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of basic fungicidal or basic yeasticidal activity of chemical disinfectants and antiseptics --- Test method and requirements (phase 1). London, UK:British Standards Institution;British Standard BS EN 1275:2005. Chemical disinfectants and antiseptics --- Quantitative carrier test for the evaluation of fungicidal or yeasticidal activity for instruments used in the medical area --- Test method and requirements (phase 2, step 2). London, UK:British Standards Institution;British Standard BS EN 14562:2006. Chemical disinfectants and antiseptics --- Quantitative suspension test for the evaluation of fungicidal or yeasticidal activity of chemical disinfectants and antiseptics used in the veterinary area --- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1657:2005. Chemical disinfectants and antiseptics --- Application of European Standards for chemical disinfectants and antiseptics. London, UK:British Standards Institution;British Standard BS EN 14885:2006. Cosmetics --- Microbiology --- Enumeration of yeast and mould. London, UK:British Standards Institution;British Standard Draft ISO 16212:2007. Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003. U.S. Pharmacopeia General Chapters: <1072> Disinfectants and Antiseptics. Rockville, MD. USP34-NF29, 2011 U.S. Pharmacopeia General Chapters: <61> Microbial Examination of Nonsterile Products: Microbial Enumeration Tests. Rockville, MD USP34-NF29, 2011 U.S. Pharmacopeia General Chapters:<62> Microbiological Examination of Nonsterile Products: Tests for Specified Microorganisms. Rockville, MD USP34-NF29, 2011 ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions) Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM. Wagner T, et al. pH-dependent denaturation of extracellular aspartic proteinases from Candida species. J. Med. Vet. Mycol. 33: 275-278, 1995. PubMed: 8531028 |
| 梅經(jīng)理 | 17280875617 | 1438578920 |
| 胡經(jīng)理 | 13345964880 | 2438244627 |
| 周經(jīng)理 | 17757487661 | 1296385441 |
| 于經(jīng)理 | 18067160830 | 2088210172 |
| 沈經(jīng)理 | 19548299266 | 2662369050 |
| 李經(jīng)理 | 13626845108 | 972239479 |
